RLKdb

Functional domain topology: Signal-PF01453-PF00954-PF08276-TM-Kinase-PF11883-
(extracellular: , Intracellular: )

No.	Type	PFamID	Location	Short name	Description
1	Signal	-	1-20	-
2	Domain	PF01476	36-67	LysM	LysM domain
3	Domain	PF01476	86-107	LysM	LysM domain
4	Domain	PF08276	108-167	PN_2	PAN-like domain
5	Transmembrane	-	202-215	TM	200
6	Kinase	PF07714	280-336	PK_Tyr_Ser-Thr	Protein tyrosine and serine/threonine kinase
7	Domain	PF11883	380-436	DUF3403	Domain of unknown function (DUF3403

The recommended qPCR primer pair: 1

	Forward	Reverse
Sequence	ATCGGCTTGTTCGTTCTCGT	CGTCATCCGCCGTGAAATTC
Location(Len)	2046,20	2178,20
Temperature	60.039	59.974
GC content	50	55
Hairpin	38.33	0
Stability	4.18	2.17
Product size	133
Product temperature	87.1

The recommended qPCR primer pair: 2

	Forward	Reverse
Sequence	GGAAGCAACAACTTCAGCGG	CTTCAAATTAGGCGCGCTCC
Location(Len)	1395,20	1526,20
Temperature	60.04	59.972
GC content	55	55
Hairpin	46.48	0
Stability	5.52	4.7
Product size	132
Product temperature	85

The recommended qPCR primer pair: 3

	Forward	Reverse
Sequence	GGGAAGCAACAACTTCAGCG	CTTCAAATTAGGCGCGCTCC
Location(Len)	1394,20	1526,20
Temperature	60.04	59.972
GC content	55	55
Hairpin	46.48	0
Stability	5.18	4.7
Product size	133
Product temperature	85.2

The recommended qPCR primer pair: 4

	Forward	Reverse
Sequence	TTTCACGAACGAGCTTCCGA	CGCTGAAGTTGTTGCTTCCC
Location(Len)	1262,20	1413,20
Temperature	59.969	60.04
GC content	50	55
Hairpin	0	42.98
Stability	4.55	3.97
Product size	152
Product temperature	82.9

The recommended qPCR primer pair: 5

	Forward	Reverse
Sequence	TTTCACGAACGAGCTTCCGA	CCGCTGAAGTTGTTGCTTCC
Location(Len)	1262,20	1414,20
Temperature	59.969	60.04
GC content	50	55
Hairpin	0	42.98
Stability	4.55	3.46
Product size	153
Product temperature	83

Hit AlphaFold protein: AF-A0A5C7INF6-F1
Alignment information: Coverage=100.095, evalue=0 misMatch=12, gap=2

Ligand binding sites in AF-A0A5C7INF6-F1

No.	Score	Prob.	pocket_center_x	pocket_center_y	pocket_center_z	pocket_residue_ids
1	23.64	0.891	6.6099	-3.7285	0.0757	296 298 299 320 342 344 346 347 368 370 371 390 392 395 414 416 418 438 440 442 462 709 710 711 712 723 725 728 729 732 761 800 803 805
2	10.24	0.550	-12.0922	9.3877	-10.4529	738 739 740 741 743 744 746 758 760 792 808 809 810 811 814 815 818 866 867 869 879 880
3	7.66	0.405	-5.6395	-0.3102	15.0787	178 200 222 224 226 248 251 270 272 296 298 719 720 721 723
4	5.62	0.270	1.3218	-2.0051	-13.8981	438 461 462 464 485 486 509 510 532 556 731 732 737 740 745 747 761 805
5	0.95	0.005	-17.2480	16.9926	-22.4958	817 864 902 928 934 935
6	0.72	0.002	-21.9940	7.3960	25.6449	138 142 143 151 175

3D-structure of AF-A0A5C7INF6-F1

Prediction of RLK's potential interacting proteins based on the experimentally validated protein interactions collected in the STRING database.
The interolog score reflects the likelihood of the predicted RLK protein-protein interaction.The higher the score, the greater the likelihood of interaction.
A score of 100 indicates that the interaction is experimentally validated and collected in the STRING database.
Hover on blue STRING name to show detail function description.

Explore transcription factor binding sites(TFBS)

No.	TF_name	TF_family	TF_class	TF_sepcies	Binding upstream site	Binding sequence
1	AHL12		A.T hook factors	Arabidopsis thaliana	CM059866.1(-):58953524-58953531	AATTAATT
2	AHL25		A.T hook factors	Arabidopsis thaliana	CM059866.1(-):58953524-58953531	AATTAATT
3	ATHB-12	HD-ZIP	Homeo domain factors	Arabidopsis thaliana	CM059866.1(-):58953855-58953862	AATGATTG
4	ATHB-16	HD-ZIP	Homeo domain factors	Arabidopsis thaliana	CM059866.1(-):58953394-58953401	TAATAATT
5	ATHB-51	HD-ZIP	Homeo domain factors	Arabidopsis thaliana	CM059866.1(-):58953390-58953397	AATTATTG
6	Dof2	DOF	Other C4 zinc finger-type factors	Zea mays	CM059866.1(-):58951991-58951996	AAAGCA
7	Dof2	DOF	Other C4 zinc finger-type factors	Zea mays	CM059866.1(-):58953191-58953196	AAAGCA
8	DOF2.4	DOF	Other C4 zinc finger-type factors	Arabidopsis thaliana	CM059866.1(-):58953815-58953821	AAAAAGT
9	DOF5.3	DOF	Other C4 zinc finger-type factors	Arabidopsis thaliana	CM059866.1(-):58952241-58952247	GAAAAAG
10	DOF5.3	DOF	Other C4 zinc finger-type factors	Arabidopsis thaliana	CM059866.1(-):58952266-58952272	GAAAAAG
11	MNB1A	DOF	Other C4 zinc finger-type factors	Zea mays	CM059866.1(-):58951992-58951996	AAAGC
12	MNB1A	DOF	Other C4 zinc finger-type factors	Zea mays	CM059866.1(-):58953192-58953196	AAAGC
13	PBF	DOF	Other C4 zinc finger-type factors	Zea mays	CM059866.1(-):58951992-58951996	AAAGC
14	PBF	DOF	Other C4 zinc finger-type factors	Zea mays	CM059866.1(-):58953192-58953196	AAAGC

Explore RLK gene features in DNA and its functional domains in protein

To zoon in: Left click to select area of interest;
To zoom out: Right click to reset the scale

Gene features in DNA

Functional domains in protein

Domain type	ID	Location	Short name	Description
Signal peptide	-	1-36	-	Signal peptide region
Domain	PF13855	218-278	LRR_8	Leucine rich repeat
Transmembrane	-	672-692	TM	Transmembrane region
Kinase	PF00069	735-1004	Pkinase	Protein kinase domain