RLKdb

Functional domain topology: Signal-PF01453-PF00954-PF08276-TM-Kinase-PF11883-
(extracellular: , Intracellular: )

No.	Type	PFamID	Location	Short name	Description
1	Signal	-	1-20	-
2	Domain	PF01476	36-67	LysM	LysM domain
3	Domain	PF01476	86-107	LysM	LysM domain
4	Domain	PF08276	108-167	PN_2	PAN-like domain
5	Transmembrane	-	202-215	TM	200
6	Kinase	PF07714	280-336	PK_Tyr_Ser-Thr	Protein tyrosine and serine/threonine kinase
7	Domain	PF11883	380-436	DUF3403	Domain of unknown function (DUF3403

The recommended qPCR primer pair: 1

	Forward	Reverse
Sequence	CACTTGTCACCGTGTTGCTG	TTCAAGCACTCCAGGACGTC
Location(Len)	1939,20	2077,20
Temperature	59.972	59.966
GC content	55	55
Hairpin	0	0
Stability	4.41	4.34
Product size	139
Product temperature	83.9

The recommended qPCR primer pair: 2

	Forward	Reverse
Sequence	CAACCTTCTTGCCCGTCTCT	CAGCAACACGGTGACAAGTG
Location(Len)	1842,20	1958,20
Temperature	59.965	59.972
GC content	55	55
Hairpin	0	46.47
Stability	3.1	3.16
Product size	117
Product temperature	86.1

The recommended qPCR primer pair: 3

	Forward	Reverse
Sequence	CATGTCCTCCATTGCTGGGT	AGCCTGGAGTCCAAGATTGC
Location(Len)	2549,20	2791,20
Temperature	60.034	60.035
GC content	55	55
Hairpin	43.34	30.8
Stability	4.51	3.56
Product size	243
Product temperature	86.2

The recommended qPCR primer pair: 4

	Forward	Reverse
Sequence	CAACCTTCTTGCCCGTCTCT	TTCAAGCACTCCAGGACGTC
Location(Len)	1842,20	2077,20
Temperature	59.965	59.966
GC content	55	55
Hairpin	0	0
Stability	3.1	4.34
Product size	236
Product temperature	86.9

The recommended qPCR primer pair: 5

	Forward	Reverse
Sequence	AAGATGCTGGACGTGTCGTT	GGAAGCGGTCCAAGGAAGAA
Location(Len)	1083,20	1198,20
Temperature	59.966	59.964
GC content	50	55
Hairpin	41.37	46.97
Stability	3.85	2.52
Product size	116
Product temperature	82.4

Hit AlphaFold protein: AF-A0A2C9VWB0-F1
Alignment information: Coverage=100%, evalue=0 misMatch=0, gap=0

Ligand binding sites in AF-A0A2C9VWB0-F1

No.	Score	Prob.	pocket_center_x	pocket_center_y	pocket_center_z	pocket_residue_ids
1	9.59	0.516	7.5246	-1.7995	-17.6138	460 482 484 506 508 529 530 532 554 556 854 858 861 866 867 900 902 905
2	9.58	0.515	-12.9064	14.1283	-27.8480	698 699 700 701 703 704 706 718 720 750 766 767 769 772 773 776 821 822 824 834 835
3	3.96	0.157	3.4216	-2.0441	6.0601	296 317 319 320 341 343 363 365 387 389 953 955 956
4	2.36	0.061	7.0011	-1.2737	0.9179	343 365 368 387 389 391 411 413 952 953
5	1.98	0.042	13.8900	5.9837	-27.2925	532 556 559 578 579 580 582 583 602 603 895 899 900
6	1.85	0.036	10.9762	-2.9859	20.2172	303 307 310 313 316 330 334
7	1.84	0.036	-13.1391	-3.0619	18.8860	150 170 172 194 198 218 220
8	1.77	0.032	0.6247	13.0506	-23.1093	779 820 821 860 892 893 894
9	1.76	0.032	-3.3434	27.6352	-4.9715	788 789 792 935 938 941 970
10	1.75	0.032	8.5091	-1.8454	-5.6661	391 413 415 437 863 867 952

3D-structure of AF-A0A2C9VWB0-F1

Prediction of RLK's potential interacting proteins based on the experimentally validated protein interactions collected in the STRING database.
The interolog score reflects the likelihood of the predicted RLK protein-protein interaction.The higher the score, the greater the likelihood of interaction.
A score of 100 indicates that the interaction is experimentally validated and collected in the STRING database.
Hover on blue STRING name to show detail function description.

Explore transcription factor binding sites(TFBS)

No.	TF_name	TF_family	TF_class	TF_sepcies	Binding upstream site	Binding sequence
1	ARALYDRAFT_484486	TCP	Basic helix-loop-helix factors (bHLH)	Arabidopsis lyrata subsp. lyrata	LG5(+):20712946-20712953	GGCCCCAC
2	ARALYDRAFT_495258	TCP	Basic helix-loop-helix factors (bHLH)	Arabidopsis lyrata subsp. lyrata	LG5(+):20712946-20712953	GGCCCCAC
3	Dof2	DOF	Other C4 zinc finger-type factors	Zea mays	LG5(+):20712365-20712370	AAAGCA
4	Dof2	DOF	Other C4 zinc finger-type factors	Zea mays	LG5(+):20712499-20712504	AAAGCA
5	DOF5.3	DOF	Other C4 zinc finger-type factors	Arabidopsis thaliana	LG5(+):20712362-20712368	GAAAAAG
6	MNB1A	DOF	Other C4 zinc finger-type factors	Zea mays	LG5(+):20711980-20711984	AAAGC
7	MNB1A	DOF	Other C4 zinc finger-type factors	Zea mays	LG5(+):20712324-20712328	AAAGC
8	MNB1A	DOF	Other C4 zinc finger-type factors	Zea mays	LG5(+):20712365-20712369	AAAGC
9	MNB1A	DOF	Other C4 zinc finger-type factors	Zea mays	LG5(+):20712499-20712503	AAAGC
10	MNB1A	DOF	Other C4 zinc finger-type factors	Zea mays	LG5(+):20713104-20713108	AAAGC
11	PBF	DOF	Other C4 zinc finger-type factors	Zea mays	LG5(+):20711980-20711984	AAAGC
12	PBF	DOF	Other C4 zinc finger-type factors	Zea mays	LG5(+):20712324-20712328	AAAGC
13	PBF	DOF	Other C4 zinc finger-type factors	Zea mays	LG5(+):20712365-20712369	AAAGC
14	PBF	DOF	Other C4 zinc finger-type factors	Zea mays	LG5(+):20712499-20712503	AAAGC
15	PBF	DOF	Other C4 zinc finger-type factors	Zea mays	LG5(+):20713104-20713108	AAAGC

Explore RLK gene features in DNA and its functional domains in protein

To zoon in: Left click to select area of interest;
To zoom out: Right click to reset the scale

Gene features in DNA

Functional domains in protein

Domain type	ID	Location	Short name	Description
Signal peptide	-	1-22	-	Signal peptide region
Domain	PF08263	24-65	LRRNT_2	Leucine rich repeat N-terminal domain
Domain	PF13855	92-128	LRR_8	Leucine rich repeat
Domain	PF13855	137-177	LRR_8	Leucine rich repeat
Domain	PF13855	264-322	LRR_8	Leucine rich repeat
Domain	PF13855	408-444	LRR_8	Leucine rich repeat
Domain	PF13855	527-586	LRR_8	Leucine rich repeat
Transmembrane	-	641-660	TM	Transmembrane region
Kinase	PF07714	693-967	PK_Tyr_Ser-Thr	Protein tyrosine and serine/threonine kinase