RLKdb

Functional domain topology: Signal-PF01453-PF00954-PF08276-TM-Kinase-PF11883-
(extracellular: , Intracellular: )

No.	Type	PFamID	Location	Short name	Description
1	Signal	-	1-20	-
2	Domain	PF01476	36-67	LysM	LysM domain
3	Domain	PF01476	86-107	LysM	LysM domain
4	Domain	PF08276	108-167	PN_2	PAN-like domain
5	Transmembrane	-	202-215	TM	200
6	Kinase	PF07714	280-336	PK_Tyr_Ser-Thr	Protein tyrosine and serine/threonine kinase
7	Domain	PF11883	380-436	DUF3403	Domain of unknown function (DUF3403

The recommended qPCR primer pair: 1

	Forward	Reverse
Sequence	TTTGTTGGCAGCATTCCAGC	ACTTCTGGCCCACCACAAAA
Location(Len)	1641,20	1876,20
Temperature	59.966	60.033
GC content	50	50
Hairpin	29.02	42.67
Stability	4.85	2.44
Product size	236
Product temperature	82.6

The recommended qPCR primer pair: 2

	Forward	Reverse
Sequence	GCGGACCACTTCCTCTTGAA	TTTCACAGTTGCCCAATGCG
Location(Len)	1501,20	1608,20
Temperature	59.965	59.968
GC content	55	50
Hairpin	43.25	45.6
Stability	2.69	4.73
Product size	108
Product temperature	81.1

The recommended qPCR primer pair: 3

	Forward	Reverse
Sequence	TGACGGCTCATGTTGGAGAC	CCTGCATATTCAGGCGCAAC
Location(Len)	2560,20	2695,20
Temperature	60.037	59.97
GC content	55	55
Hairpin	39.67	46.11
Stability	3.36	4.17
Product size	136
Product temperature	80.9

The recommended qPCR primer pair: 4

	Forward	Reverse
Sequence	AAGCGGACCACTTCCTCTTG	TTTCACAGTTGCCCAATGCG
Location(Len)	1499,20	1608,20
Temperature	59.965	59.968
GC content	55	50
Hairpin	46.06	45.6
Stability	3.02	4.73
Product size	110
Product temperature	80.9

The recommended qPCR primer pair: 5

	Forward	Reverse
Sequence	TTTTGTGGTGGGCCAGAAGT	AGAGAACTGCAATGACCGCA
Location(Len)	1857,20	2004,20
Temperature	60.033	59.965
GC content	50	50
Hairpin	46.72	37.88
Stability	3.01	5.69
Product size	148
Product temperature	82.1

Hit AlphaFold protein: AF-A0A2T7CKM7-F1
Alignment information: Coverage=100%, evalue=0 misMatch=0, gap=0

Ligand binding sites in AF-A0A2T7CKM7-F1

No.	Score	Prob.	pocket_center_x	pocket_center_y	pocket_center_z	pocket_residue_ids
1	11.42	0.610	-5.8365	5.1410	-38.3771	711 712 713 714 717 719 732 734 763 784 785 786 787 790 791 794 846 847 849 860
2	5.05	0.230	-13.9512	-9.6551	-33.6172	683 684 686 690 692 747 748 751 752 767 768 770 780
3	3.78	0.146	10.2917	-9.5430	-21.4120	518 520 542 544 545 566 568 569 588 590 592 593 613 739 741
4	3.74	0.143	-3.0067	2.2523	-28.2469	713 714 715 716 717 734 746 842 844 860 862 863
5	3.40	0.122	2.2406	2.9381	7.5899	298 319 321 322 347 349 351 352 374 377 398 400
6	2.78	0.085	1.9785	-9.5032	-38.3893	695 704 705 718 720 735 736 737 739 773 778 779
7	2.72	0.082	-2.4634	21.0907	-19.2253	891 893 895 910 914 925 935 936 937 989
8	1.78	0.033	-2.2623	2.3385	11.2002	273 295 297 298 317 319 321 347 349
9	1.57	0.024	-19.9252	12.8985	-18.2271	831 832 837 867 905 906 909 997 998 999

3D-structure of AF-A0A2T7CKM7-F1

Prediction of RLK's potential interacting proteins based on the experimentally validated protein interactions collected in the STRING database.
The interolog score reflects the likelihood of the predicted RLK protein-protein interaction.The higher the score, the greater the likelihood of interaction.
A score of 100 indicates that the interaction is experimentally validated and collected in the STRING database.
Hover on blue STRING name to show detail function description.

Explore transcription factor binding sites(TFBS)

No.	TF_name	TF_family	TF_class	TF_sepcies	Binding upstream site	Binding sequence
1	ATHB-51	HD-ZIP	Homeo domain factors	Arabidopsis thaliana	8(+):3105876-3105883	AATTATTG
2	DOF2.4	DOF	Other C4 zinc finger-type factors	Arabidopsis thaliana	8(+):3105801-3105807	AAAAAGT
3	ERF018	ERF/DREB	AP2/EREBP	Arabidopsis thaliana	8(+):3106470-3106477	ACCGACCA
4	MNB1A	DOF	Other C4 zinc finger-type factors	Zea mays	8(+):3106039-3106043	AAAGC
5	MNB1A	DOF	Other C4 zinc finger-type factors	Zea mays	8(+):3106462-3106466	AAAGC
6	PBF	DOF	Other C4 zinc finger-type factors	Zea mays	8(+):3106039-3106043	AAAGC
7	PBF	DOF	Other C4 zinc finger-type factors	Zea mays	8(+):3106462-3106466	AAAGC

Explore RLK gene features in DNA and its functional domains in protein

To zoon in: Left click to select area of interest;
To zoom out: Right click to reset the scale

Gene features in DNA

Functional domains in protein

Domain type	ID	Location	Short name	Description
Signal peptide	-	1-23	-	Signal peptide region
Domain	PF08263	29-67	LRRNT_2	Leucine rich repeat N-terminal domain
Domain	PF12799	75-103	LRR_4	Leucine Rich repeats (2 copies)
Domain	PF13855	117-156	LRR_8	Leucine rich repeat
Domain	PF13855	265-325	LRR_8	Leucine rich repeat
Domain	PF13855	344-404	LRR_8	Leucine rich repeat
Domain	PF13855	542-596	LRR_8	Leucine rich repeat
Transmembrane	-	651-671	TM	Transmembrane region
Kinase	PF00069	707-1002	Pkinase	Protein kinase domain